Review



morpholino to irx3b  (Gene Tools Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Gene Tools Inc morpholino to irx3b
    Morpholino To Irx3b, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/morpholinos+to+irx3b/morpholino+to+irx3b/pmc06250424-179-5-18
    Average 90 stars, based on 1 article reviews
    morpholino to irx3b - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: A novel mechanism of gland formation in zebrafish involving transdifferentiation of renal epithelial cells and live cell extrusion
    Article Snippet: Previously validated morpholinos to irx3b (5′- ACCGGGAGGACTGCGGGGAAACTCG -3′ (R. A. )) and hnf1bb (5’-CTTGGACACCATGTCAGTAAA-3’ ( )) were purchased from Gene Tools LLC and resuspended in 1X Danieau solution.



    Similar Products

    morpholino to irx3b  (Gene Tools Inc)
    90
    Gene Tools Inc morpholino to irx3b
    Morpholino To Irx3b, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/morpholinos+to+irx3b/morpholino+to+irx3b/pmc06250424-179-5-18
    Average 90 stars, based on 1 article reviews
    morpholino to irx3b - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    morpholinos to irx3b  (Gene Tools Inc)
    90
    Gene Tools Inc morpholinos to irx3b
    Morpholinos To Irx3b, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/morpholinos+to+irx3b/morpholino+to+irx3b/bio_rxiv__353524-163-2-19
    Average 90 stars, based on 1 article reviews
    morpholinos to irx3b - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    morpholino irx3b  (Gene Tools Inc)
    90
    Gene Tools Inc morpholino irx3b
    Morpholino Irx3b, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/morpholinos+to+irx3b/morpholino+to+irx3b/pmc03537220-220-25-33
    Average 90 stars, based on 1 article reviews
    morpholino irx3b - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results